How to Solve Repeated D N A Sequences Leetcode Problem - Interview Coder Guide
Used by 97,000+ developers who passed their interviews

How to Solve Repeated D N A Sequences Problem

Master the Repeated D N A Sequences LeetCode problem with undetectable real-time assistance. Get instant solutions and explanations during your coding interviews.

Interview Coder generates complete solutions and debugging hints that you can use while explaining your approach, so you stay calm and in control.

undetectable
real-time
works on major platforms
Medium#187
LeetCode Problem

Repeated DNA Sequences

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'. For example, "ACGAATTCCG" is a DNA sequence. When studying DNA, it is useful to identify repeated sequenc...

Hash TableStringBit Manipulation+3 more

Interview Coder will help you solve this problem in real-time during your interview

Problem Breakdown

Understanding the Repeated D N A Sequences Problem

Let's break down this LeetCode problem and understand what makes it challenging in interview settings.

Problem Statement

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'. For example, "ACGAATTCCG" is a DNA sequence. When studying DNA, it is useful to identify repeated sequences within the DNA. Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

MediumProblem #187
LeetCode

Repeated DNA Sequences

Related Topics
Hash TableStringBit ManipulationSliding WindowRolling HashHash Function
How Interview Coder Helps

Get real-time assistance for Repeated DNA Sequences problems during coding interviews. Interview Coder provides instant solutions and explanations.

Examples

Example 1
INPUT
s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
OUTPUT
["AAAAACCCCC","CCCCCAAAAA"]
Example 2
INPUT
s = "AAAAAAAAAAAAA"
OUTPUT
["AAAAAAAAAA"]

Constraints

1 <= s.length <= 105
s[i] is either 'A', 'C', 'G', or 'T'.

How Interview Coder Helps with Leetcode Problems

Trust anchors reduce friction for conversion. Reinforce undetectability claims, platform compatibility, user counts, and the free trial to remove perceived risk.

97,000+
developers use Interview Coder
and early launch metrics showed rapid adoption
95%
success rate
of users pass their interviews
100%
undetectable
native desktop architecture
Real-time
assistance
instant solutions during interviews

See Interview Coder in Action

Watch how Interview Coder helps solve LeetCode problems during live interviews

Play

Undetectability Checklist

Run compatibility test before interviews
Use recommended Zoom version settings
Enable advanced screen capture options
Verify native desktop architecture
Test with screen recording software

Platform Compatibility

Zoom
Supported
Google Meet
Supported
HackerRank
Supported
CodeSignal
Supported
CoderPad
Supported
Teams
Supported

User results and traction

More than 87,000 developers use Interview Coder and early launch metrics showed rapid adoption. Social proof signals that this approach helps real candidates land offers across a range of companies.

Undetectability and technical details

Our native desktop architecture avoids common detection vectors used by browser extensions. We provide a clear checklist so you can run basic checks and confirm the app will be invisible during live interviews.

Platform compatibility and limitations

We work with Zoom, HackerRank, CodeSignal, CoderPad and other web based platforms, with a known list of app version caveats. Check the compatibility note and request a browser link if a specific desktop app is unsupported.

Frequently Asked Questions

Common questions about solving Repeated D N A Sequences and using Interview Coder during coding interviews.

Interview Coder generates complete solutions instantly with proper complexity analysis, letting you focus on explaining your approach and demonstrating problem-solving skills rather than getting stuck on implementation details during high-pressure situations.

Interview Coder - AI Interview Assistant Logo

Ready to Get Started?

Download Interview Coder now and join thousands of developers who have aced their coding interviews