How to Solve Repeated D N A Sequences Problem
Master the Repeated D N A Sequences LeetCode problem with undetectable real-time assistance. Get instant solutions and explanations during your coding interviews.
Interview Coder generates complete solutions and debugging hints that you can use while explaining your approach, so you stay calm and in control.
Repeated DNA Sequences
The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'. For example, "ACGAATTCCG" is a DNA sequence. When studying DNA, it is useful to identify repeated sequenc...
Interview Coder will help you solve this problem in real-time during your interview
Understanding the Repeated D N A Sequences Problem
Let's break down this LeetCode problem and understand what makes it challenging in interview settings.
Problem Statement
The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'. For example, "ACGAATTCCG" is a DNA sequence. When studying DNA, it is useful to identify repeated sequences within the DNA. Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.
Repeated DNA Sequences
Related Topics
How Interview Coder Helps
Get real-time assistance for Repeated DNA Sequences problems during coding interviews. Interview Coder provides instant solutions and explanations.
Examples
s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"["AAAAACCCCC","CCCCCAAAAA"]s = "AAAAAAAAAAAAA"["AAAAAAAAAA"]Constraints
1 <= s.length <= 105s[i] is either 'A', 'C', 'G', or 'T'.How Interview Coder Helps with Leetcode Problems
Trust anchors reduce friction for conversion. Reinforce undetectability claims, platform compatibility, user counts, and the free download to remove perceived risk.
See Interview Coder in Action
Watch how Interview Coder helps solve LeetCode problems during live interviews
Undetectability Checklist
Platform Compatibility
User results and traction
More than 87,000 developers use Interview Coder and early launch metrics showed rapid adoption. Social proof signals that this approach helps real candidates land offers across a range of companies.
Undetectability and technical details
Our native desktop architecture avoids common detection vectors used by browser extensions. We provide a clear checklist so you can run basic checks and confirm the app will be invisible during live interviews.
Platform compatibility and limitations
We work with Zoom, HackerRank, CodeSignal, CoderPad and other web based platforms, with a known list of app version caveats. Check the compatibility note and request a browser link if a specific desktop app is unsupported.
Frequently Asked Questions
Common questions about solving Repeated D N A Sequences and using Interview Coder during coding interviews.
Interview Coder generates complete solutions instantly with proper complexity analysis, letting you focus on explaining your approach and demonstrating problem-solving skills rather than getting stuck on implementation details during high-pressure situations.
$799 Lifetime. 100,000+ Users. Zero Detection Cases.
The only AI interview tool with face-shown real interview recordings and verified offer letters. Try free, or go lifetime — unlike AI Apply, no hidden credit costs.